Protocol for Making ChronoSeq V5 Beads by Modifying Dropseq beads.

This protocol is for Making 3ml of Beads per time-tag. Ideal for production run using ChronoSeq Device.

Bead Modification Workflow

Sequences are added by using an oligo that binds to the existing PolyT region on Drop-seq beads. The 3’ end of the Drop-seq beads are then extended to the reverse compliment of the oligo using E. Coli DNA Polymerase I. Alkaline denaturation is used to make the double stranded DNA single-stranded. These beads are then resuspended in lysis buffer and can be used directly with our device.

Dropseq beads Properties and Sticker Sequence

• LGC Biosearch Technologies have started offering these beads.
• These beads have a longer UMI length of 14 instead of 8 for Chemgenes. The sequence for these beads is as follows:
  • 5’–Bead–Linker-‐TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC JJJJJJJJJJJJNNNNNNNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-‐3’
• They also claim better quality control and fewer particles that can cause a blockage in the Microfluidic Chip.
• You can order them here.
  • Catalog Number: NX-SCB-200/18 million beads. Cost about 7000USD January 2025.
• We used about ~3ml of beads at @450beads/μl per Time-Tag

Time-Tagged Sticker Oligos for making ChronoSeq V4 Beads using Dropseq beads

All Oligos were ordered from IDT

• 25nmol Scale
• Standard Desalting

• SEQ1_TTGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTHGHGB AAAAAAAAAAAAAAAAAAA
• SEQ2_CCTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCDTNTB AAAAAAAAAAAAAAAAAAA
• SEQ3_GGAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGHANAB AAAAAAAAAAAAAAAAAAA
• SEQ4_TTCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTDCDCB AAAAAAAAAAAAAAAAAAA
• SEQ5_TTAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTSANAB AAAAAAAAAAAAAAAAAAA
• SEQ6_TTTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TVTVTVTB AAAAAAAAAAAAAAAAAAA
• SEQ7_CCAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCKANAB AAAAAAAAAAAAAAAAAAA
• SEQ8_CCGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCWGHGB AAAAAAAAAAAAAAAAAAA
• SEQ9_CCCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCDCDCB AAAAAAAAAAAAAAAAAAA
• SEQ10_GGTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGMTNTB AAAAAAAAAAAAAAAAAAA
• SEQ11_GGCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGWCDCB AAAAAAAAAAAAAAAAAAA
• SEQ12_GGGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGHGHGB AAAAAAAAAAAAAAAAAAA

Solutions and Buffers to Make

Use Distilled Water for all these Buffers. Please also filter using a 40μm Cell Strainer.

• TE-SDS:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.5% SDS

• TE-TW:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.01% Tween-20

• IDTE Buffer:

  • 10 mM Tris HCl pH 8.0 + 0.1mM EDTA

Buffer for Dissolving and Diluting Oligos Ordered from IDT

• 1M DTT:
  • Dissolve 1.55g solid DTT in 10ml of Deionized Water. Hazardous Chemical Read SDS. Work in Fume Hood

More economical to make yourself from Solid DTT. Make 50ml or more at a time and store in 10ml Aliquots for upto an year. DTT is not stable at room temperature. Make this solution quickly and store at -20°C, unless you plan to use it immediately to make another Buffer.

• 10X NEB Buffer 2:
  • 500 mM NaCl
  • 100 mM Tris-HCl pH 7.9
  • 100 mM MgCl₂
  • 10 mM DTT

Make in Bulk for Scaling up reaction. It is more economical than buying NEB Buffer 2. Make 100ml or more at a time and store in 11ml Aliquots for upto an year.

DTT is not stable at room temperature. Make this solution quickly and store at -20°C.

Best Practices:

1. Remember to put back the reagents back to their storage location at 4°C or -20°C once you are done with using them.
2. Get fresh new microtips/sterile-disposable pipettes after each step, unless mentioned otherwise.
   • Important to avoid cross-contamination.

Equipment Used:

• Our lab uses the refrigerated Sorval ST8R Centrifuge. You can find CAD files to print some of the parts here.
  • We bought the 50ml Inserts and Printed the Rest.
  • You can modify the CAD files to print the 50ml Inserts as well.
  • Use PLA or TPU for the prints.
• Microcentrifuge we used was the Fisherbrand™ accuSpin™ Micro 17/17R Microcentrifuge
• Labnet Nutating Mixer
• CELLTREAT Pipette Controller
  • Replacement Filters
• Labnet Vortex
• Eppendorf Pipettes 6-Pack
• VWR Scientific Products 1545 General Purpose Incubator (Discontinued Product)
• Pipette Tips:
  • Genesee Scientific 200/20μl Tips
  • Rainin 1000μl Tips
  • Genesee Scientific 10μl Tips
• Larger Volume Pipettes:
  • 5ml Pipette
  • 10ml Pipette
  • 25ml Pipette
  • 50ml Pipette
• Disposable Sterile Falcon Tubes:
  • 50ml Tubes
  • 15ml Tubes
• Disposable Sterile 250ml GL45 Bottles, Individually Wrapped

Protocol for Bead Modification

💡 Tip: Our lab uses the refrigerated Sorval ST8R Centrifuge. You can find CAD files to print some of the parts here.

Preparation of Beads

• Use the instructions in this section to make 10μM stocks for the Sticker Oligos ordered from IDT, using the IDTE buffer.
• Each unit of Dropseq beads comes in a separate vial. Follow the ChronoSeq beads preparation protocol and suspend the Dropseq Beads from the Alcohol stock at -20°C to 1X Lysis buffer at 4°C.
  • You will need about 3ml of beads @450beads/μl per Time-Tag for this protocol.
    • Therefore, if you are making 4 Time-Tags you will need 12ml of Beads@450beads/μl suspended in 1X Lysis buffer for this protocol.
    • Typically Chemgenes provides 6 million beads per vial so one vial should provide enough beads for making 4 separate Time-Tags.
    • Other manufactures might provide different quantitites of beads per vial. Make the calculation and suspend the beads from each vial accordingly.
  • We have tested this protocol with upto 3.2ml so far.
  • 4ml might also work.
  • Further testing and optimization of Reagent concentrations and reaction times might be needed for larger volumes.
• Spin Down Dropseq beads with 450beads/μl suspended in 1X Lysis buffer.
• Turn on the UV and airflow for the Cell Culture Hood. Leave for 15 minutes.
• Inside the Cell Culture Hood: Shake Each Tube to make sure the beads are evenly suspended . For each Tube using a Sterile/Particle Free 5ml Pipette transfer 3ml of beads to a Sterile 50ml Falcon Tube.
• Put the main 50ml Tubes with Dropseq beads back in their storage location at 4°C once you are done.
• Turn off the Cell Culture Hood and move to your bench. Take the 50ml Tubes with 3ml beads at 450beads/μl with you.

This is a STOPPING STEP. You can store the Beads in 1X Lysis Buffer at 4°C and continue later.

DNA Polymerase I Isothermal Extension for Making ChronoSeq V4 Beads

• Get the 50ml Tubes with 3ml Dropseq beads suspended in 1X Lysis buffer.
• Set the incubator to 34°C
• Get the dNTP, 10μM Sticker Oligos and homemade NEB Buffer 2 from -20°C and leave on your bench to melt. Put on ice once melted.

💡 Tip: Make sure you have enough volume of dNTPs, Oligos and Buffer for your experiments.

• Get the DNA Polymerase I from -20°C and put it on ice.
• Make 1.25X NEB Buffer 2 and put on ice.
• Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
• Remove 2 ml of Lysis buffer without disturbing the beads.
• Set your Electronic Pipette to its Fastest Setting.
  • From now onwards always dispense liquid at Full Speed into the Tube.
  • Dispense near the mouth of the Tube to avoid pushing air into the liquid.
  • Do not immerse the Pipette into the liquid when dispensing.
  • We want to avoid Vortexing to prevent the beads from breaking into smaller fragments.
  • By dispensing at full speed we want the beads to mix well with the liquid as we are dispensing the liquid into the tube.
• Now wash the beads 3 Times with 5ml 1.25X NEB Buffer 2:
  • Add 5ml 1.25X NEB Buffer 2.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 5ml 1.25X NEB Buffer 2.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible disturbing the beads.
  • Add 5ml 1.25X NEB Buffer 2.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
• Estimate the Volume using a 5ml Pipette.
• Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
• Remove liquid without distrubing the beads to make the final Volume 3.2ml.
• Now add:
  • 200μl of a 10μM ChronoSeqV4 Sticker Oligo. Pipette up and down several times to mix well.
    • Be careful not to mix Different Sticker Oligos together. Only one Sticker Oligo per 4ml Reaction.
  • 200μl dNTP mix from NEB
  • 390μl Distilled Water
  • 10μl DNA Polymerase I . Use the P10 , Pipette up and down several times to mix well.
• Gently swirl the Tube to allow proper mixing.
• Quickly spin down the Tube at 2500xg for 30seconds. NO SOFT DECELERATION
• Make sure the Caps for the Tubes are tightly closed to avoid any leaks during the reaction.
• Now Incubate at 34°C on a Nutating Mixer for 1.5 hours.
• Keep the Beads on Ice to slow down the reaction.
• Spin down the beads. The Centrifuge should be set to 2500xg @4°C for 1.5 minutes with Soft Deceleration Enabled.
• Keep the Beads on ice and only take one Falcon Tube out of the Ice at a time.
  • Additional reactions can degrade the beads. Keeping them on Ice as much as possible help prevent degradation.
  • These additional reactions can especially become a problem when you are making 12 Time-Tags at the same time.
    • Spinning down all 12 Tubes for each Time-Tag can take a long time.
    • If the Tubes are left at Room temperature during this time there is a high chance for these additional reactions.
    • This may not be a problem if you are making 4 or fewer Time-Tags. As all the Tubes can be spun down at the same time with little waiting between steps.
• Without disturbing the beads remove 3ml of Buffer.
• Wash the beads once with TE-SDS and then twice with TE-TW:
  • Add 10 ml of TE-SDS to the Tube.
  • Vigorously shake the tube for 5 seconds
  • Spin down the beads. The Centrifuge should be set to 2500xg @4°C for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml of TE-TW.
  • Gently swirl the Tube to allow proper mixing.
  • Spin down the beads. The Centrifuge should be set to 2500xg @4°C for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml of TE-TW.

This is a STOPPING STEP. You can store the Beads in TE-TW at 4°C and continue later.

• Wash the beads twice with Distilled Water:
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml of Distilled Water.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml of Distilled Water.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
• Carefully remove as much Liquid possible without disturbing the beads.

Protocol for Converting dsDNA on the Beads to ssDNA using Alkaline Denaturation

• Sodium Hydroxide is a very dangerous Chemical it can melt your Skin and turn your body into Soap. You need to be extra careful.
• Wear Lab Coat, Safety Glasses, Face-Sheild, Double Nitrile Gloves and work in the Fume Hood.
• Tape the First Layer of Gloves to your labcoat to avoid exposing your skin accidentally.
  • Execute the cell below to watch the video.
  • Put on a second layer of gloves on top after you have taped the first layer.

%%HTML
<iframe width="800" height="600" src="https://www.youtube.com/embed/T7JGnFHAbhU?si=7X8rGl0iXm3G1dOH" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" allowfullscreen></iframe>

• Replace the work area mats with Fresh new ones.
• Make sure there is enough space to work inside the Fume hood.
• Bring the 10M NaOH Bottle stored under your bench in a secondary container to the Fume Hood. You should always store the bottle inside a secondary container inside another larger container.
• You will need one Black Hazardous Waste Bin for the Pipettes. Bring The Black Waste Bin into The Fume Hood. Check the Waste Tag to make sure this is the correct Bin.

💡 Tip: Make sure you have enough volume of Denaturation Solution and 1M Tris-HCl pH 7.5 for your experiments.

• You will also need a Buffer to Dispose off the 1M NaOH washed through.
• For this purpose I recommend having 150ml of 1M Tris-HCl pH 7.5 in a 250ml GL-45 Plastic Bottle. Label this Bottle: Neutralization.
• Set aside enough of 1M Tris-HCl pH 7.5 in a different 250ml Bottle for washing the Beads. Label this Tube: Washing.
• You will also need to prepare a Spray Bottle full of 1M Tris-HCl pH 7.5 Buffer. This will act as our emergency spray in case of a spill. Label This bottle correctly and Keep it inside the Fume Hood. Very important to have this with you.

✶ Important: Discard the Pipettes used for Handling NaOH into the Black Hazardous Waste Bin.
In case of a Spill: Spray all affected surfaces with the 1M Tris-HCl pH 7.5.

• We Will now make Fresh Denaturation Solution. To Make 30ml of Denaturation Solution:
  • 27ml of Distilled Water
  • 3ml of 10N NaOH.
  • Pipette up and down to mix well.
  • Discard the NaOH contaminated Pipette into the Black Bin.
• Once you have made enough Denaturation Solution, put the 10M NaOH back in its storage location inside its secondary container. Make sure the 10M NaOH bottle is closed tightly.
• Change your gloves.
• Now wash the beads thrice with 10ml Denaturation Solution:
  • Add 10ml of Denaturation Solution to the Beads. Discard the Pipette into the Black Bin.
  • Incubate at Room temperature on the Nutation Mixer for 5 minutes.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads. Discard this liquid into the Neutralization Bottle.
  • Now Discard the Pipette into the Black Bin.
  • Add 10ml of Denaturation Solution to the Beads. Discard the Pipette into the Black Bin.
  • Incubate at Room temperature on the Nutation Mixer for 5 minutes.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads. Discard this liquid into the Neutralization Bottle.
  • Now Discard the Pipette into the Black Bin.
  • Add 10ml of Denaturation Solution to the Beads. Discard the Pipette into the Black Bin.
  • Incubate at Room temperature on the Nutation Mixer for 5 minutes.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads. Discard this liquid into the Neutralization Bottle.
  • Now Discard the Pipette into the Black Bin.
• Now wash once with 10ml 1M Tris-HCl pH 7.5:
  • Add 10ml of 1M Tris-HCl pH 7.5 from the Washing Bottle to the Beads. Discard the Pipette into the Black Bin.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads. Discard this liquid into the Neutralization Bottle.
  • Now Discard the Pipette into the Black Bin.
• Store the Black bin, Face Sheild, Spray Bottle and other items in their correct location.
• Use pH test Paper to check the pH of the Neutralization Bottle. If the pH is less than 10 you can pour it in the sink. Additional Dilution with 1M Tris-HCl pH 7.5 might be needed if its greater in pH.
• You can now move back to your bench from the fume hood.
• You can make 50ml of 1X Lysis buffer by mixing 15 ml of 3.33X Buffer with 35ml of Distilled Water.
• With the Cap closed shake the 1X Lysis buffer vigorously to mix well.
• Filter the 1X Lysis buffer using a 40μm Falcon Cell Strainer (Blue Color).
• Wash the beads thrice with 10ml 1X Lysis Buffer:
  • Add 10ml 1X Lysis Buffer.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml 1X Lysis Buffer.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.
  • Carefully remove as much Liquid possible without disturbing the beads.
  • Add 10ml 1X Lysis Buffer.
  • Spin down the beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled.

This is a STOPPING STEP. You can store these beads in 1X Lysis Buffer at 4°C.

Filter and Prepare Beads for ChronoSeq Device

• Turn on the UV for the Cell Culture Hood and wait 15 minutes.
• Turn on the Cell Culture hood and clean your work area. From this point onwards work aseptically inside the Cell culture hood.
• Use Compressed Air to Remove any particles from the 50ml Falcon Tubes used for all the steps below.
  • Remove the Particles before moving onto the next step.
  • Execute the Cell Below to Watch a Video of the Process.

%%HTML
<iframe width="800" height="600" src="https://www.youtube.com/embed/BZua7OioLm0?si=6kGb2lyEvrFbnQA4" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" referrerpolicy="strict-origin-when-cross-origin" allowfullscreen></iframe>

• Now Filter these beads twice with the 70μm Pluriselect Filters (white Color). From this step onwards its is very important to make sure no particles get into the Lysis buffer with the beads.
• Shake the 50ml Tube gently by hand to evenly resuspend the beads.
  • Take a P200 and set it to 20μl. Now using Sterile/Particle-Free 200μl Tips take a sample and transfer it to a Hemocytometer for counting.
  • Make sure the beads are evenly suspended in the Hemocytometer.
• Spin down the Beads. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled at 21°C.
• Estimate the Total Volume of Beads in Lysis buffer using a Sterile/Particle-Free 10ml Pipette.
• Calculate the Final Volume of Lysis buffer needed for concentration of 450beads/μl.
• Spin the Beads down. The Centrifuge should be set to 2500xg for 1.5 minutes with Soft Deceleration Enabled at 21°C.
• Remove the calculated volume of 1X Lysis buffer to get the final desired concentration of 450beads/μl, without disturbing the beads.
• Remember to add the following Labels to this Final Tube:
  • Date
  • The Timepoint/Seq-number/Bead-Type
  • The concentration of beads: 450beads/μl
  • Media in which the beads are suspended: 1X Lysis buffer
  • Final volume of beads in the Tube.

This is a STOPPING STEP. You can store the Beads in 1X Lysis Buffer at 4°C and continue later.

Protocol for Preparing Tubes for Priming and Timepoints/Injections

• You should work inside the Cell Culture hood to avoid introduction of Dust particles or Debris.

✶ Important Note: Do not mix different types of beads such as ChronoSeq and Dropseq beads. Also don't mix different timepoints together. It is important you process them separately.

• For each separate timepoint/bead type (such as Dropseq beads):
  • Label a Sterile/Particle-Free 50ml Falcon Tube with the Bead-Type/Timepoint, the date, the batch and the bead Reservoir Number it will be loaded into for the ChronoSeq Device.
  • Shake the beads each time to make sure the beads have a uniform concentration then, transfer 1ml of Beads each to Separate 50ml Falcon Tubes. Use Sterile/Particle-Free Rainin 1000μl Pipette tips.

  ✶ Important Note:Try be be as close to 1ml of Beads as possible. Less than 0.8ml of Beads can introduce bubbles into the Chrono-Seq device and cause blockages.

  • Put the Beads inside the refrigerator at 4°C before the experiment.
  • Prepare remaining tubes for Priming the Chronoseq device. The first section of this protocol has instructions.
  • Remember to spin down the beads before you load them into the Chrono-Seq device.