This protocol is deprecated please see latest V5 protocol.

Protocol for Making ChronoSeq V4 Beads by Modifying Dropseq beads for Bulk Time Series.

This protocol is for making 400μl of Beads for each Time-Tag. Ideal for Testing in Bulk Time Series.

Bead Modification Workflow

Sequences are added by using an oligo that binds to the existing PolyT region on Drop-seq beads. The 3’ end of the Drop-seq beads are then extended to the reverse compliment of the oligo using E. Coli DNA Polymerase I. Single-stranded DNA are removed using Exonuclease 1. This leaves only double-stranded DNA on the beads that cannot capture RNA. Therefore, Alkaline denaturation is used to make the double stranded DNA single-stranded. These beads are then resuspended in lysis buffer and can be used directly with our device.

Dropseq beads Properties and Sticker Sequence

5’–Bead–Linker-‐TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC JJJJJJJJJJJJNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-‐3’ Beads were ordered from Chemgenes and synthesized at a 10μmol Starting Scale.

• We ordered 3 Units of Dropseq beads for making these beads.
  • Catalog Number: Macosko-2011-10(V+)
• Each unit gives us between 12-15ml of Beads @450beads/μl
• We used 400μl of beads at @450beads/μl per Time-Tag

Update: New Supplier

• LGC Biosearch Technologies have started offering these beads.
• If you use the LGC beads make sure you use the same amount of beads for each reaction.
• These beads have a longer UMI length of 14 instead of 8 for Chemgenes. The sequence for these beads is as follows:
  • 5’–Bead–Linker-‐TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC JJJJJJJJJJJJNNNNNNNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-‐3’
• They also claim better quality control and fewer particles that can cause a blockage in the Microfluidic Chip.
• You can order them here.

Time-Tagged Sticker Oligos for making ChronoSeq V4 Beads using Dropseq beads

All Oligos were ordered from IDT

• 25nmol Scale
• Standard Desalting

• SEQ1_TTGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTHGHGB AAAAAAAAAAAAAAAAAAA
• SEQ2_CCTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCDTNTB AAAAAAAAAAAAAAAAAAA
• SEQ3_GGAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGHANAB AAAAAAAAAAAAAAAAAAA
• SEQ4_TTCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTDCDCB AAAAAAAAAAAAAAAAAAA
• SEQ5_TTAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TNTSANAB AAAAAAAAAAAAAAAAAAA
• SEQ6_TTTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TVTVTVTB AAAAAAAAAAAAAAAAAAA
• SEQ7_CCAA: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCKANAB AAAAAAAAAAAAAAAAAAA
• SEQ8_CCGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCWGHGB AAAAAAAAAAAAAAAAAAA
• SEQ9_CCCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CDCDCDCB AAAAAAAAAAAAAAAAAAA
• SEQ10_GGTT: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGMTNTB AAAAAAAAAAAAAAAAAAA
• SEQ11_GGCC: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGWCDCB AAAAAAAAAAAAAAAAAAA
• SEQ12_GGGG: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GHGHGHGB AAAAAAAAAAAAAAAAAAA

Solutions and Buffers to Make

Use Distilled Water for all these Buffers. Please also filter using a 40μm Cell Strainer.

• STOP Buffer:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.5% Sarcosyl
  • 330mM KCl

• WASH Buffer:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.01% Tween-20
  • 330mM KCl

• TE-SDS:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.5% SDS

• TE-TW:

  • 10 mM Tris HCl pH 8.0 + 1 mM EDTA
  • 0.01% Tween-20

• IDTE Buffer:

  • 10 mM Tris HCl pH 8.0 + 0.1mM EDTA

Buffer for Dissolving and Diluting Oligos Ordered from IDT

• 1M DTT:
  • Dissolve 1.55g solid DTT in 10ml of Deionized Water. Hazardous Chemical Read SDS. Work in Fume Hood

More economical to make yourself from Solid DTT. Make 50ml or more at a time and store in 10ml Aliquots for upto an year. DTT is not stable at room temperature. Make this solution quickly and store at -20°C, unless you plan to use it immediately to make another Buffer.

• 10X NEB Buffer 2:
  • 500 mM NaCl
  • 100 mM Tris-HCl pH 7.9
  • 100 mM MgCl₂
  • 10 mM DTT

Make in Bulk for Scaling up reaction. It is more economical than buying NEB Buffer 2. Make 100ml or more at a time and store in 11ml Aliquots for upto an year.

DTT is not stable at room temperature. Make this solution quickly and store at -20°C.

Best Practices:

1. Remember to put back the reagents back to their storage location at 4°C or -20°C once you are done with using them.
2. Get fresh new microtips/sterile-disposable pipettes after each step, unless mentioned otherwise.
   • Important to avoid cross-contamination.

Equipment Used:

• Our lab uses the refrigerated Sorval ST8R Centrifuge. You can find CAD files to print some of the parts here.
  • We bought the 50ml Inserts and Printed the Rest.
  • You can modify the CAD files to print the 50ml Inserts as well.
  • Use PLA or TPU for the prints.
• Microcentrifuge we used was the Fisherbrand™ accuSpin™ Micro 17/17R Microcentrifuge
• Labnet Rotating Mixer
• CELLTREAT Pipette Controller
  • Replacement Filters
• Labnet Vortex
• Eppendorf Pipettes 6-Pack
• VWR Scientific Products 1545 General Purpose Incubator (Discontinued Product)
• Pipette Tips:
  • Genesee Scientific 200/20μl Tips
  • Rainin 1000μl Tips
  • Genesee Scientific 10μl Tips
• Larger Volume Pipettes:
  • 5ml Pipette
  • 10ml Pipette
  • 25ml Pipette
  • 50ml Pipette
• Disposable Sterile Falcon Tubes:
  • 50ml Tubes
  • 15ml Tubes
• Disposable Sterile 250ml GL45 Bottles, Individually Wrapped

Protocol for Bead Modification

Preparation of Beads

• Use the instructions in this section to make 10μM stocks for the Sticker Oligos ordered from IDT, using the IDTE buffer.
• Follow the ChronoSeq beads preparation protocol and suspend the Dropseq Beads from the Alcohol stock at -20°C to 1X Lysis buffer at 4°C.
  • You will need about 400μl of beads @450beads/μl per Time-Tag for this protocol.
• Spin Down Dropseq beads with 450beads/μl suspended in 1X Lysis buffer.
• Turn on the UV and airflow for the Cell Culture Hood. Leave for 15 minutes.
• Inside the Cell Culture Hood: Shake Each Tube to make sure the beads are evenly suspended . For each Tube using a Sterile/Particle Free Rainin P1000 pipette tip transfer 400μl of beads to a Sterile 1.5ml Eppendorf Tube.
• Put the main 50ml Tubes with Dropseq beads back in their storage location at 4°C once you are done.
• Turn off the Cell Culture Hood and move to your bench. Take the eppies with 400μl beads at 450beads/μl with you.

This is a STOPPING STEP. You can store the Beads in 1X Lysis Buffer at 4°C and continue later.

DNA Polymerase I Isothermal Extension

• Get the eppies with 400μl of Dropseq beads suspended in 1X Lysis buffer.
• Set an incubator to 34°C
• Get the dNTP, 10μM Sticker Oligos and NEB Buffer 2 from -20°C and leave on your bench to melt. Put on ice once melted.

💡 Tip: Make sure you have enough volume of dNTPs, Oligos and Buffer for your experiments.

• Get the DNA Polymerase I from -20°C and put it on ice.
• Make 1.25X NEB Buffer 2 and put on ice.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Remove 300μl of Lysis buffer without disturbing the beads.
• Now wash the beads 3 Times with 1ml 1.25X NEB Buffer 2:
  • Add 1ml 1.25X NEB Buffer 2. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml 1.25X NEB Buffer 2. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml 1.25X NEB Buffer 2. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Without disturbing the beads remove 400μl of Buffer.
• Estimate the Volume using the P1000.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Remove liquid without distrubing the beads to make the final Volume 320μl.
• Now add:
  • 20μl of 10μM Sticker Oligo for ChronoSeq-V4. Pipette up and down several times to mix well.
  • 20μl dNTP mix from NEB
  • 39μl Distilled Water
  • 1μl DNA Polymerase I . Use the P2.5 , Pipette up and down several times to mix well.
• Vortex the Beads at full speed for 2 seconds to mix everything well.
• Now Incubate at 34°C with Rotation for 1.5 hours.
• Set the incubator to 37°C after you are done using it.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Without disturbing the beads remove 200μl of Buffer.
• Wash the beads once with STOP Buffer and then twice with WASH Buffer:
  • Add 1 ml of STOP Buffer to the eppie.
  • Flip the tube upside down a few times and then Vortex the beads at full speed for 2 seconds.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of WASH Buffer. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of WASH Buffer. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.

This is a STOPPING STEP. You can store the Beads in WASH Buffer at 4°C and continue later.

Exonuclease 1 Digestion

• Make sure the incubator is Set to 37°C.
• Get the Exonuclease 1 Buffer -20°C and leave on your bench to melt. Put on ice once melted.

💡 Tip: Make sure you have enough volume of Exonuclease 1 Buffer for your experiment.

• Get the Exonuclease 1 from -20°C and put it on ice.
• Make 1.25X Exonuclease 1 Buffer and put it on ice.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Wash twice with 1ml of 1.25X Exonuclease 1 Buffer:
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1 ml of 1.25X Exo 1 buffer to the eppie. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1 ml of 1.25X Exo 1 buffer to the eppie. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Remove 400μl of Liquid from the eppie without disturbing the beads.
• Without touching the beads, slightly pipette up and down using the P1000 to resuspend the beads in solution.
• Now estimate the Volume in the eppie by using the P1000.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Using the estimated volume in the eppie, make the final volume of the eppie 320μl without disturbing the beads.
• Then add the following to the eppie :
  • 30μl Distilled Water
  • 50μl Exonuclease 1 . Pipette up and down many times to mix well.
• Vortex the Beads to Mix everything Well.
• Now Incubate at 37°C with Rotation for 2 hours.
• Set the incubator to 42°C after you are done using it.
• Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Without disturbing the beads remove 200μl of Buffer.
• Wash the beads once with TE-SDS and then twice with TE-TW:
  • Add 1 ml of TE-SDS to the eppie.
  • Flip the tube upside down a few times and then Vortex the beads at full speed for 2 seconds.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of TE-TW. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of TE-TW. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.

This is a STOPPING STEP. You can store the Beads in TE-TW at 4°C and continue later.

• Wash the beads twice with Distilled Water:
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of Distilled Water. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml of Distilled Water. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• Carefully remove 1ml of Liquid without disturbing the beads.

Protocol for Converting dsDNA on the Beads to ssDNA using Alkaline Denaturation

• Sodium Hydroxide is a very dangerous Chemical it can melt your Skin and turn your body into Soap. You need to be extra careful.
• Wear Lab Coat, Safety Glasses, Face-Sheild, Double Nitrile Gloves and work in the Fume Hood.
• Tape the First Layer of Gloves to your labcoat to avoid exposing your skin accidentally.
  • Execute the cell below to watch the video.
  • Put on a second layer of gloves on top after you have taped the first layer.

%%HTML
<iframe width="800" height="600" src="https://www.youtube.com/embed/T7JGnFHAbhU?si=7X8rGl0iXm3G1dOH" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" allowfullscreen></iframe>

• Replace the work area mats with Fresh new ones.
• Make sure there is enough space to work inside the Fume hood.
• Bring the 10M NaOH Bottle stored under your bench in a secondary container to the Fume Hood. You should always store the bottle inside a secondary container inside another larger container.
• You will need one Black Hazardous Waste Bin for the Pipettes. Bring The Black Waste Bin into The Fume Hood. Check the Waste Tag to make sure this is the correct Bin.

💡 Tip: Make sure you have enough volume of Denaturation Solution and 1M Tris-HCl pH 7.5 for your experiments.

• You will also need a Buffer to Dispose off the 1M NaOH washed through.
• For this purpose I recommend having between 30-40ml of 1M Tris-HCl pH 7.5 in a 50ml Tube Ready. Label this Tube: Neutralization.
• Set aside enough of 1M Tris-HCl pH 7.5 in a different tube for washing the Beads. Label this Tube: Washing.
• You will also need to prepare a Spray Bottle full of 1M Tris-HCl pH 7.5 Buffer. This will act as our emergency spray in case of a spill. Label This bottle correctly and Keep it inside the Fume Hood. Very important to have this with you.

✶ Important: Discard the tips used for Handling NaOH into the Black Hazardous Waste Bin.
In case of a Spill: Spray all affected surfaces with the 1M Tris-HCl pH 7.5.

• We Will now make Fresh Denaturation Solution. To Make 1ml of Denaturation Solution:
  • 900μl of Distilled Water
  • 100μl of 10N NaOH.
  • Pipette up and down to mix well.
  • Discard the NaOH contaminated tip into the Black Bin.
• Once you have made enough Denaturation Solution, put the 10M NaOH back in its storage location inside its secondary container. Make sure the 10M NaOH bottle is closed tightly.
• Change your gloves.
• Now wash the beads thrice with 1ml Denaturation Solution:
  • Now Carefully Add 1ml of Denaturation Solution to the Beads. Discard the Tip into the Black Bin.
  • Vortex the Beads at Maximum Speed for 3 seconds to Mix Well.
  • Incubate at Room temperature with Rotation for 5 minutes.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads. Discard this liquid into the Neutralization Tube.
  • Now Discard the Tip into the Black Bin.
  • Now Carefully Add 1ml of Denaturation Solution to the Beads. Discard the Tip into the Black Bin.
  • Vortex the Beads at Maximum Speed for 3 seconds to Mix Well.
  • Incubate at Room temperature with Rotation for 5 minutes.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads. Discard this liquid into the Neutralization Tube.
  • Now Discard the Tip into the Black Bin.
  • Now Carefully Add 1ml of Denaturation Solution to the Beads. Discard the Tip into the Black Bin.
  • Vortex the Beads at Maximum Speed for 3 seconds to Mix Well.
  • Incubate at Room temperature with Rotation for 5 minutes.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads. Discard this liquid into the Neutralization Tube.
  • Now Discard the Tip into the Black Bin.
• Now wash Twice with 1ml 1M Tris-HCl pH 7.5:
  • Now Carefully Add 1ml of 1M Tris-HCl pH 7.5 from the Washing tube to the Beads. Discard the Tip into the Black Bin.
  • Vortex the Beads at Maximum Speed for 3 seconds to Mix Well.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads. Discard this liquid into the Neutralization Tube.
  • Now Discard the Tip into the Black Bin.
  • Now Carefully Add 1ml of 1M Tris-HCl pH 7.5 from the Washing tube to the Beads. Discard the Tip into the Black Bin.
  • Vortex the Beads at Maximum Speed for 3 seconds to Mix Well.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads. Discard this liquid into the Neutralization Tube.
• Store the Black bin, Apron, Spray Bottle and other items in their correct location.
• Use pH test Paper to check the pH of the Neutralization Tube. If the pH is less than 10 you can pour it in the sink. Additional Dilution with 1M Tris-HCl pH 7.5 might be needed if its greater in pH.
• You can now move back to your bench from the fume hood.
• Wash the beads thrice with 1ml 1X Lysis Buffer:
  • Add 1ml 1X Lysis Buffer. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml 1X Lysis Buffer. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Carefully remove 1ml of Liquid without disturbing the beads.
  • Add 1ml 1X Lysis Buffer. Vortex the beads at full speed for 2 seconds to resuspend the beads if necessary.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
• We now need to make a Final concentration of 450beads/μl:
  • Remove 300μl of Lysis buffer.
  • Vortex the beads at Maximum Speed for 3 seconds and then quickly take a 20μl Sample using the P200. Without delay transfer this sample to a Fuchs-Rosenthal Hemocytometer
  • Count the Beads to get the Bead Concentration. Count at least 5 large squares to get the bead concentration per μl
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Estimate the Volume of the Beads using a P1000.
  • Spin down the beads using a tabletop centrifuge @ 2500xg for 1 minute.
  • Without disturbing the beads, remove the calculated amount of liquid to get a Final Concentration of 450beads/μl.

This is a STOPPING STEP. You can store the Beads in 1X Lysis Buffer at 4°C and continue later.

• Follow the Bulk RNA Seq protocol to verify your beads are working or not.
• Follow the Bulk RNA Seq section for the ChronoSeq device if you plan to do a time-series assay.